Skip to content

Analytical and Clinical Validation of a Digital Sequencing Panel for Quantitative, Highly Accurate Evaluation of Cell-Free Circulating Tumor DNA #
Find similar titles

Structured data

About
Cell-free tumor DNA
Date Published
Publisher
PLOS One
URL

ctDNA NGS를 위한 두가지 도전이 있다.

  1. Genomic target deep sequencing
  2. Invasive tissue biopsies를 또하지 않도록

Digital sequencing은 혈액 테스트로 50개 암 유전자를 ctDNA high-quality sequencing 한다. 민감도는 변이 allele 0.1% 미만.

Near-perfect analytic specificity(>99.9999%)는 일반적인 암 유전변이를 위양성없이 확인하게 한다.

Digital sequencing 기술을 tissue-based sequecing 162 pairs 3-4기 암환자시료와 비교했더니 이 기술은 민감도 85%, 조직기반은 80%. 연속샘플 1000개의 임상 성공율은 99.8%.

Summary #

Introduction #

ctDNA는 대체로 166 bp double-stranded DNA fragment로 Apoptosis, Necrosis 혹은 핵 DNA가 혈액으로 유출되면서 나타난다. 이 조각은 1.5시간의 짧은 반감기를 갖고 간 또는 신장에서 분해된다. 이는 실시간 genomic signature를 보여준다.

ctDNA NGS의 핵심도전은 낮은 농도의 변이 DNA 조각 신호가 시퀀싱 장비의 노이즈로 파악하기 어렵다는 것.

Guardant360Digital Sequencing을 이용한 ctDNA 탐지용 54 유전자 (512 exones) NGS panel이다. 54개 유전자의 SNV와 EGFR, ERBB2, MET의 CNV 탐지 가능.

Digital sequencing employs pre-sequencing preparation of a digital library of individually tagged cfDNA molecules combined with post-sequencing bioinformatic reconstruction to eliminate nearly all false positives.

타겟 영역이 커짐에 따라 위양성율이 증가하므로, hotspot, hot exone 영역만 대상으로 함

Digital sequencingWES와 비교해서 민감도를 위한 새로운 표준을 만들었다. 약 1.6 Mbp를 시퀀싱하면서, 낮은 위양성율의 mutation call을 수행한다.

이 방법은 300-400 gene tissue-based NGS panel에 비해 적지만, 실제 advanced cancer 환자의 3/4 이상을 탐지함

Results #

Digital sequencing methodology vs. traditional NGS #

Analytic specificity and sensitivity #

Assay robustness/interference from genomic DNA secondary to storage time and temperature variation #

Assessment of copy number variation (CNV) #

Observational data from 510 patient multicenter study and 1,000 consecutive samples in clinical practice #

Analysis of control samples from healthy persons #

Clinical validation of the cfDNA panel #

Discussion #

Conclusions #

Materials and Methods #

Characteristics of the Guardant360 panel and clinical diagnostic assay #

Guardant360 ids SNVs of 54 genes 78 kbps (all exons but 18 genes critical exons) and CNVs for ERBB2, EGFR, MET

유전자 목록은 FDA 승인된 맞춤 치료 가능 목록

Guardant360 target region was 78 kbps per sample, 8,000X (min average base coverage 3,000X and min Qscore 20)

2 10ml tubes of whole blood --> formaldehyde-free 보관하면 상온 7일 보관

cfDNA fragments are converted to digital sequence library.

Bioinformatics processing of cell-free DNA sequencing data and variant calling #

Digital Sequencing signal processing for removal of false positive errors.

각 strand를 별도로 태깅 - 분석시 매칭하여 오류 보정

CASAVA, BWA-MEM, custome pile-up processs

  1. 150bp paire-end reads aligned to reference
  2. Trim_galore in cutadapt removes 3' adapters
  3. Using custom script, remove unaligned and low quality tails, adapters
  4. Ids all germline SNP, somatic SNV, remove errors

For CNV or amplification, z-score > 2.5758

Accuracy and Analytic Specificity for SNVs #

The primer sets (Primer ID Hs00326065_CE, Life Technologies) were designed to amplify a 509 bp region in HRAS at chr11:532242–535550. The forward primer (CTCTAGAGGAAGCAGGAGACAGG) binds at position chr11:532242–535550 and the reverse primer (CATCACTGGGTCATTAAGAGCAA) binds at position chr11:534081–534589.

Analytic Sensitivity for SNVs #

Precision for SNVs #

Analytic Sensitivity and Specificity of Copy Number Variation #

Assay Robustness #

Patient samples #

Clinical Validity #

Incoming Links #

Related Articles #

Suggested Pages #

web biohackers.net
0.0.1_20140628_0